Primer Tm Calculator
Melting temperature (Tm) decides whether your PCR primers anneal cleanly or misprime. This primer Tm calculator computes Tm four ways, nearest-neighbor (SantaLucia 1998 with the Owczarzy 2004 salt correction), salt-adjusted, basic, and Wallace, side by side so you can sanity-check any vendor tool. It adds polymerase-specific annealing suggestions (Taq, Q5, Phusion, Pfu) and an optional second primer for a pair-compatibility verdict. This is an independent free tool, not affiliated with NEB; it uses the same published model family that their calculator is built on. Once your primers arrive, our concentration calculator helps with stock and working concentrations, and our dilution and molarity calculator handles the C1V1 = C2V2 arithmetic so a pipetting slip doesn’t ruin the reaction. Our dilution calculator works out exactly how much buffer to add for the standard 100 µM stock.
Non-ATGC characters are ignored. This tool computes duplex melting temperature only; it does not check hairpins or primer-dimers, which are the most common reason a high-Tm primer still fails.
Quick Answer
Primer melting temperature depends on the method: for the 20-mer GATTTGGTCGTATTGGGCGC at 50 mM Na+ and 250 nM primer, nearest-neighbor gives 56.3°C, salt-adjusted 48.8°C, basic 53.8°C, and Wallace 62.0°C. With Taq polymerase the suggested annealing temperature is 51.3°C (Tm minus 5). Enter your sequence above for all four methods plus a pair-compatibility check.
- Quick Answer
- Worked example, checked against this exact tool
- What melting temperature actually means
- The four methods in this calculator
- How salt and primer concentration move the number
- Primer design guidelines that actually matter
- Annealing temperature by polymerase
- What the tool does not do (read this before trusting a number)
- Cross-checking against NEB and IDT
- How this tool compares to the other Tm calculators
Worked example, checked against this exact tool
The 20-mer GATTTGGTCGTATTGGGCGC at 50 mM Na+ and 250 nM primer concentration gives 56.3 C by nearest-neighbor (GC content 55%), compared with 62.0 by Wallace, 53.8 by the basic formula, and 48.8 salt-adjusted: this spread is normal and is exactly why the comparison table exists. With Taq polymerase selected, the suggested annealing temperature is 51.3 C (Tm minus 5). Add the partner primer GCGCCCAATACGACCAAATC as the second sequence and the pair check reports a delta Tm of 0.1 C: a good pair, with the shared annealing suggestion taken from the cooler of the two primers.
What melting temperature actually means
Tm is the temperature at which half of the primer molecules are bound to their perfect complement and half are free in solution. PCR annealing works a few degrees below Tm, where nearly all primers bind, but not so far below that they bind to wrong sites. That is why every annealing suggestion on this page is expressed as Tm minus an offset rather than as a fixed temperature.
The four methods in this calculator
- Nearest-neighbor (SantaLucia 1998 ): sums the thermodynamic contribution (dH, dS) of each adjacent base pair using the unified parameter set, adds initiation and terminal A/T penalties, and applies the Owczarzy 2004 salt correction. Most accurate for primers of 14 nt and longer; the method NEB, IDT, and Primer3 all use.
- Salt-adjusted: Tm = 81.5 + 16.6 log10(Na+) + 41(GC − 16.4) / N. The classic textbook formula; good for a quick check.
- Basic: Tm = 64.9 + 41(GC − 16.4) / N. A rough estimate that ignores salt entirely.
- Wallace rule: Tm = 2(A+T) + 4(G+C). A back-of-the-envelope rule for short oligos; it overestimates for longer primers, which is why the tool switches short sequences to it automatically.
How salt and primer concentration move the number
More salt shields the negative charges on the DNA backbones, so the duplex holds together at higher temperature: raising Na+ raises Tm. The Owczarzy correction used here models this as 1/Tm(Na+) = 1/Tm(1M) + (4.29 × GC fraction − 3.95) × 10−5 ln[Na+] + 9.40 × 10−6 ln2[Na+]. Primer concentration matters too: more primer drives binding, so higher concentration raises Tm slightly (the R ln(C/4) term). Note that this correction is expressed as Na+-equivalent; buffers rich in Mg2+ need a different correction, which is one reason two tools can disagree.
Primer design guidelines that actually matter
- Length 18 to 24 nt is the sweet spot for standard PCR; shorter primers lose specificity, longer ones invite secondary structure.
- GC content 40 to 60% gives a Tm in the convenient 55 to 65 C range.
- A 3-prime GC clamp (one or two G/C bases at the 3′ end) strengthens binding where the polymerase starts; the tool reports your clamp status.
- Pair delta Tm under 5 C: both primers must anneal at the same temperature, so the shared annealing suggestion is taken from the cooler primer.
Annealing temperature by polymerase
Different polymerases prefer different margins below Tm: Taq and Pfu: Tm minus 5 C; Q5 and Phusion: Tm minus 3 C. When two primers are entered, the suggestion uses the lower of the two Tms, because annealing near the cooler primer is what keeps both primers working. Start with the suggestion and optimize empirically: too-low annealing invites mispriming, too-high annealing gives weak or no product.
What the tool does not do (read this before trusting a number)
A Tm number can be perfect while the primer still fails. This tool does not check hairpins (the primer folding on itself), self-dimers (two copies of the same primer binding), cross-dimers (forward binding reverse), or off-target binding in your template. Those checks need a dedicated analyzer such as IDT OligoAnalyzer or NCBI Primer-BLAST. Also, if your buffer uses Mg2+ heavily, treat the Na+-only correction as approximate.
Cross-checking against NEB and IDT
To verify any Tm value, run the same sequence through a second tool with identical buffer settings (same Na+, same primer concentration). Our melting temperature calculator gives the same kind of single-sequence check under matched settings. Agreement within ±1 to 2 C confirms the value is trustworthy. If two tools differ by more than 3 C, the usual causes are mismatched salt or Mg2+ settings, different polymerase buffer corrections, or a hidden hairpin that only a full analyzer flags. This page is an independent free tool, not affiliated with New England Biolabs; small differences from their calculator come from these buffer-correction choices, not from a different underlying model.
How this tool compares to the other Tm calculators
No single Tm tool does everything. NEB’s calculator is the reference most labs know, IDT’s OligoAnalyzer adds the secondary-structure checks a pure Tm tool cannot do, and scorecard-style tools give quick pass-or-fail guidance. This page sits in the middle: the same nearest-neighbor thermodynamics as the big names, with the pair and polymerase logic a quick Tm check needs, minus the account walls.
| Feature | This calculator | NEB Tm Calculator | IDT OligoAnalyzer | Typical scorecard tools |
|---|---|---|---|---|
| Nearest-neighbor Tm | Yes (SantaLucia 1998, Owczarzy 2004 salt correction) | Yes (NEB buffer model) | Yes | Yes |
| Primer-pair annealing from the cooler primer | Yes | Yes | No | No |
| Polymerase-specific annealing offsets | Yes (Taq, Q5, Phusion, Pfu) | Yes (NEB polymerases) | No | No |
| Side-by-side method comparison | Yes (four methods) | No | No | Some |
| Hairpin and primer-dimer analysis | No | Limited | Yes | No |
| Account or cost | Free, no account | Free | Free with account | Free |
The practical workflow: compute and sanity-check Tm here, pick the annealing temperature for your polymerase, then run the final pair through OligoAnalyzer or Primer-BLAST for the dimer and off-target checks this page cannot do.
What competing calculators miss
NEB-style tools give a pair annealing temperature from the lower-Tm primer but hide their model behind a product page; mirror sites repackage it thinly, sometimes even mixing the Wallace rule into the “NEB formula” description. Pure NN tools (bioprocesstools-style) give a scorecard but no polymerase-specific annealing suggestion. This page combines what each does best: the exact SantaLucia/Owczarzy computation verified by independent re-implementation, a four-method comparison table, polymerase-specific annealing from the cooler primer of the pair, a GC-clamp and pair-delta verdict, and the honest framing that a Tm number is only half of primer validation.
Frequently asked questions
The nearest-neighbor method with the SantaLucia 1998 parameters and a salt correction is the most accurate for primers of 14 nt or longer, typically within ±1 to 2 C of measured values. It is the method NEB, IDT, and Primer3 use.
They use the same thermodynamic model but different buffer corrections (Na+ vs Mg2+, polymerase-specific buffers) and primer-concentration assumptions. Run comparisons with identical settings; ±1 to 2 C agreement is normal.
Subtract a polymerase-specific offset: Tm − 5 C for Taq and Pfu, Tm − 3 C for Q5 and Phusion. With a primer pair, base it on the lower-Tm primer.
Higher salt raises Tm by shielding backbone charge repulsion. The relationship follows the Owczarzy 2004 correction: roughly, doubling Na+ adds a fraction of a degree for typical primers.
Aim for Tm 55 to 65 C and GC content 40 to 60%, with both primers of a pair within 5 C of each other.
One or two G/C bases at the 3′ end of the primer, which bind more tightly (three hydrogen bonds) and help the polymerase start extension cleanly.
Nearest-neighbor parameters are unreliable below about 14 nt, so the tool falls back to the Wallace rule (2(A+T) + 4(G+C)) for short sequences.
Start at Tm − 3 C, based on the lower-Tm primer of your pair. Q5’s high-fidelity buffer tolerates a tighter margin than Taq’s.
Within 5 C of each other. A larger gap forces you to anneal at the cooler primer’s temperature, where the hotter primer may bind less specifically.
No. This is an independent free tool that uses the same published nearest-neighbor model family. It is not affiliated with New England Biolabs.
Enter the final primer concentration in your PCR mix, usually 200 to 500 nM; the tool defaults to 250 nM. Higher concentration raises the computed Tm slightly because more primer drives duplex formation.
No. Tm is only one of several checks a primer must pass. This tool does not test for hairpins, primer-dimers, or off-target binding in your template, so run final candidates through IDT OligoAnalyzer or NCBI Primer-BLAST before ordering.
Add This Calculator to Your Website
Put this primer tm calculator on your own website or blog. Copy the code below and paste it into your page HTML. The embedded calculator updates automatically whenever we improve it.
Powered by Calculator Zilo – the embedded calculator links back to this page.
References
- SantaLucia J Jr.. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA. 1998. (Accessed Oct 16, 2026).
- Owczarzy R et al.. Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures. Biochemistry. 2004. (Accessed Oct 16, 2026).
- Rychlik W, Rhoads RE.. A computer program for selection of oligonucleotide primers for polymerase chain reactions. Nucleic Acids Res. 1989. (Accessed Oct 16, 2026).
- Wallace RB et al.. Hybridization of synthetic oligodeoxyribonucleotides to ΦX 174 DNA: the effect of single base pair mismatch. Nucleic Acids Res. 1979. (Accessed Oct 16, 2026).
- Owczarzy R et al.. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry. 2008. (Accessed Oct 16, 2026).