Melting Temperature Calculator
Melting temperature (Tm) is the point at which half of a double-stranded molecule has separated into single strands. This calculator estimates it the transparent way: pick DNA or RNA, count the bases or paste the sequence and let it count for you, enter your salt concentration, then apply the Wallace rule to short sequences and a published salt-adjusted formula to longer ones. It is still a screening estimate: it does not run nearest-neighbor thermodynamics, so check the limits before you order primers.
Screening estimate: salt is applied only by the long-sequence formulas below. The Wallace rule for short sequences, magnesium, primer concentration and nearest-neighbor stacking are not part of this tool. For final PCR primer work, confirm with a nearest-neighbor calculator set to your actual buffer.
Quick Answer
A 20-base DNA sequence with 5 A, 4 T, 6 G and 5 C bases, at the default 50 mM salt, has a melting temperature of 48.7 degrees C by the salt-adjusted formula, with 55.0% GC content and 45.0% AT content. The calculator is pre-filled with those counts. The same counts as RNA (U in place of T) give 50.4 degrees C by the published RNA equation, which is a different formula, not just a letter swap.
Key takeaways
- Two formulas, one switch: under 14 bases the Wallace rule applies; at 14 bases and above the GC-content formula takes over. The badge under your result names the formula that produced it.
- GC content is the lever. G-C pairs carry three hydrogen bonds against two for A-T, so GC-rich sequences melt hotter at the same length.
- This is a screening estimate. Salt is now an input for sequences of 14 bases or more, but primer concentration, magnesium and nearest-neighbor stacking still are not inputs here, and none of them is small enough to ignore for final primer work.
- DNA and RNA, handled separately. Picking RNA swaps T for U and switches the long-sequence equation. A pasted sequence with a letter outside its type is now rejected with an error naming the letter, instead of being silently shortened as U used to be.
- Quick Answer
- How to use the melting temperature calculator
- The formulas: DNA, RNA and salt
- Worked example: a 20-base sequence, step by step
- Checks: real runs of this calculator
- The 14-base switch, stated plainly
- Using Tm for PCR annealing temperature
- How the basic methods compare with nearest-neighbor
- What competing calculators miss
- Frequently asked questions
How to use the melting temperature calculator
Pick a method, supply the base composition, and click Calculate. The results stay hidden until you calculate, and the worked example counts (5 A, 4 T, 6 G, 5 C) are pre-filled.
- Base Count Method: type the four counts. This suits sequences you have composition data for, textbook problems, and quick checks where someone has already counted the bases.
- Sequence Entry: paste the sequence. Case does not matter, spaces and line breaks are ignored, and the tool counts A, T, G and C itself. Characters outside those four are removed before counting, so a stray primer name or numbering in the paste will not break the count, but an RNA U will be dropped rather than read as T.
- Read all four outputs: Tm in degrees Celsius, sequence length in base pairs, GC content and AT content. The reading badge under the results states which formula fired and whether your GC content sits inside the 40–60% band usually targeted for PCR primers.
- Reset restores the worked example rather than reloading the page.
Fractional counts are truncated (2.9 is read as 2) and blank count fields read as zero. If every count is zero, or a pasted sequence contains no A, T, G or C at all, the tool stops with a message instead of inventing a temperature.
The formulas: DNA, RNA and salt
Three published formulas cover this tool, chosen by nucleic acid type and length. Salt concentration [Na+] is in moles per litre (50 mM is 0.05 M), %GC is the percentage of G plus C bases, and L is the sequence length.
| Case | Formula | Source and range |
|---|---|---|
| Under 14 bases, DNA or RNA | Tm = 2 (A + T or A + U) + 4 (G + C) | Wallace rule, Wallace and colleagues, 1979. No salt term: salt is entered but not used here. |
| 14 bases or more, DNA | Tm = 81.5 + 16.6 log10[Na+] + 0.41 (%GC) minus 675 / L | Salt-adjusted GC formula (Marmur and Doty form). The basic no-salt result, 64.9 + 41 (G + C minus 16.4) / L, is still shown beside it for comparison. |
| 14 bases or more, RNA | Tm = 79.8 + 18.5 log10[Na+] + 58.4 (GC fraction) + 11.8 (GC fraction) squared minus 820 / L | RNA equation from Sambrook and Russell, Molecular Cloning. Published for salt from 0.01 to 0.40 M and GC from 30 to 75%; outside those ranges the tool warns that the result is an extrapolation. |
The calculator chooses between them automatically from the type and the total base count. The badge under every result names the formula that produced it, and for DNA sequences of 14 bases or more it also gives the basic no-salt figure, so a DNA default run can still be compared with the old tool.
Worked example: a 20-base sequence, step by step
Counts of A 5, T 4, G 6 and C 5 give a DNA Tm of 48.7 degrees C at 50 mM salt. The sequence AAAAATTTTGGGGGGCCCCC has exactly those counts, so both entry methods return the same result:
- Length: 5 + 4 + 6 + 5 = 20 bases
- 20 is 14 or more, so the salt-adjusted DNA formula applies
- 81.5 + 16.6 log10(0.05) + 0.41 times 55 minus 675 / 20 = 81.5 minus 21.6 + 22.55 minus 33.75 = 48.7 degrees C, GC 55.0%
- For comparison, the basic GC formula without salt gives 64.9 + 41 (11 minus 16.4) / 20 = 53.8 degrees C, which was the old tool’s answer for these counts
As RNA, the same counts (A 5, U 4, G 6, C 5, sequence AAAAAUUUUGGGGGGCCCCC) give 50.4 degrees C: 79.8 + 18.5 log10(0.05) + 58.4 times 0.55 + 11.8 times 0.55 squared minus 820 / 20. The RNA figure is higher even though the composition is identical, because the RNA equation is fitted separately, not derived from the DNA one. Composition first, length second: swap two G-C pairs for A-T pairs (A 7, T 6, G 4, C 3) and the same 20 DNA bases melt at 40.5 degrees C at 50 mM salt instead.
Checks: real runs of this calculator
Every row below is an actual run of the tool above at the stated salt, so you can type any of them in and get the same figures back. Long DNA rows use the default 50 mM salt unless stated otherwise.
| Input | Method applied | Length | GC | Tm |
|---|---|---|---|---|
| Sequence ATATGC | Wallace rule | 6 bp | 33.3% | 16.0 degrees C |
| Sequence GCGCGC | Wallace rule | 6 bp | 100.0% | 24.0 degrees C |
| Counts A 7, G 6 | Wallace rule | 13 bp | 46.2% | 38.0 degrees C |
| Counts A 7, G 7 | Salt-adjusted DNA, 50 mM | 14 bp | 50.0% | 32.2 degrees C |
| Sequence ATGCGTACCGTAAATGCGTA | Salt-adjusted DNA, 50 mM | 20 bp | 45.0% | 44.6 degrees C |
| Counts A 5, T 4, G 6, C 5 (worked example) | Salt-adjusted DNA, 50 mM | 20 bp | 55.0% | 48.7 degrees C |
| Same DNA counts at 100 mM salt | Salt-adjusted DNA, 100 mM | 20 bp | 55.0% | 53.7 degrees C |
| RNA sequence AUGCGAUCGUAC | Wallace rule for RNA | 12 nt | 50.0% | 36.0 degrees C |
| RNA counts A 5, U 4, G 6, C 5 | RNA salt-adjusted, 50 mM | 20 nt | 55.0% | 50.4 degrees C |
| Sequence ATGC repeated 125 times | Salt-adjusted DNA, 50 mM | 500 bp | 50.0% | 79.1 degrees C |
Read the 500 bp row as a warning label: the formula flattens out as length grows, and real long-DNA melting depends on salt and internal structure in ways a count-based formula cannot see. The range this tool is built for is oligonucleotides, roughly 6 to 60 bases. The 100 mM row shows why salt is now an input at all: the same 20 DNA bases move from 48.7 degrees C at 50 mM to 53.7 degrees C at 100 mM and down to 37.1 degrees C at 10 mM.
The 14-base switch, stated plainly
The two formulas do not meet at the boundary, and pretending otherwise would be dishonest. An all-AT 14-mer scores 11.7 degrees C from the salt-adjusted DNA formula at 50 mM salt, while the Wallace arithmetic on the same 14 bases would give 28.0 degrees C; the 13-base and 14-base rows in the checks table (38.0 degrees C, then 32.2 degrees C for a sequence that gained a G) show the seam on real runs. The seam is a property of the published basic methods, not a bug introduced here: Wallace was calibrated on short probes and overstates Tm as length grows, while the GC formulas were fitted on longer DNA and understate very short duplexes. If your sequence sits at 12 to 16 bases and the answer decides an experiment, skip both and use a nearest-neighbor tool.
Using Tm for PCR annealing temperature
Set the annealing temperature about 3 to 5 degrees C below the lower of your two primer Tm values as a starting point. For the worked example primer at 48.7 degrees C at 50 mM salt, that means a first run near 44 to 46 degrees C, then a gradient if the product is weak or smeared. The offset and the practice of optimizing it empirically come from Rychlik, Spencer and Rhoads (Nucleic Acids Research, 1990).
The offset and the practice of optimizing it empirically come from Rychlik, Spencer and Rhoads (Nucleic Acids Research, 1990). Two working rules follow from the same literature: keep a pair's two Tm values within about 5°C of each other, and treat 18 to 25 bases with 40 to 60% GC as the design window, the band the badge under your result checks. Specificity is the other half of primer design, and it is what NCBI's Primer-BLAST checks; the pairing rules behind both sit underneath trait-level genetics tools such as the eye color gene calculator as well. Once primers are designed, the bench work turns into solution maths: stock concentrations in the molecular concentration calculator and working dilutions in the chemical dilution calculator.
How the basic methods compare with nearest-neighbor
Nearest-neighbor is the accuracy standard; the Wallace rule is the speed standard; the salt-adjusted formulas sit between them. Pick by what the number will decide.
| Method | What it uses | Best for | Limits |
|---|---|---|---|
| Wallace rule | Base counts only | Very short probes, quick estimates, teaching | Overstates Tm as length grows; no salt or concentration terms |
| Salt-adjusted GC formula (DNA) and RNA equation | Base counts, length and salt | Oligos from 14 bases up, composition and buffer comparisons | Ignores base order entirely; flattens out on long DNA; RNA equation is published for 0.01 to 0.40 M salt and 30 to 75% GC |
| Nearest-neighbor | Sequence order, salt, strand concentration | Final PCR primer validation | Needs the full sequence and buffer details; slower to run by hand |
The thermodynamic case for the third row is set out in SantaLucia and Hicks’ review, The Thermodynamics of DNA Structural Motifs, and the stack parameters descend from Breslauer and colleagues’ 1986 PNAS paper. This page stays with the first two rows: they are the methods a reader can verify with a pencil, now with salt handled honestly instead of ignored.
What competing calculators miss
Tm tools tend to fail in one of two directions: too little explanation, or quiet method-swapping the reader never sees.
- Vendor nearest-neighbor tools (NEB Tm Calculator, IDT OligoAnalyzer): the accuracy benchmark, with buffer settings matched to their own enzymes. The trade-off is lock-in: settings assume their products, and the arithmetic is a black box you cannot reproduce on paper.
- Annealing-temperature tools (RevisionTown, CalculatorsHub, ToolDone): they subtract a fixed offset and hand you an annealing temperature, which conflates two different quantities: a tool that only shows Ta hides the Tm you need when you change polymerases or run a gradient.
- Formula-page calculators (Desmos Calculators and similar): some add a salt term to the GC-content formula, some cap the Wallace rule at different lengths, and few say which variant fired. Two such tools can disagree by 10°C on the same primer with no visible reason.
- The gap this page fills: both published basic formulas with the switch point stated in the open, a badge that names the formula behind every result, a checks table of real runs you can reproduce in the tool itself, and the boundary discontinuity disclosed with numbers instead of smoothed over.
Frequently asked questions
Tm is the temperature at which half of a double-stranded DNA sample has separated into single strands, and half remains double-stranded. It measures how stable the duplex is: the higher the Tm, the more heat the molecule withstands before its two strands come apart.
Three published formulas, chosen automatically by nucleic acid type and length. Under 14 bases it uses the Wallace rule, Tm = 2 x (A + T or A + U) + 4 x (G + C). At 14 bases or more, DNA uses the salt-adjusted formula Tm = 81.5 + 16.6 log10[Na+] + 0.41 x (%GC) minus 675 / length, and RNA uses Tm = 79.8 + 18.5 log10[Na+] + 58.4 x (GC fraction) + 11.8 x (GC fraction) squared minus 820 / length. The badge under every result names the formula that produced it, and for DNA it also gives the basic no-salt figure for comparison.
G-C base pairs are held by three hydrogen bonds, against two for A-T pairs, and G-C stacks also interact more strongly with their neighbours. Both effects mean a GC-rich duplex needs more thermal energy to pull apart, which is why the Wallace rule charges 4 degrees per G-C pair and only 2 per A-T pair.
Yes. Choose Sequence Entry and paste the sequence: lowercase works, spaces and line breaks are ignored, and the calculator counts the bases itself for the selected type (A, T, G, C for DNA; A, U, G, C for RNA). Any other letter stops the calculation with an error naming the letter, so a stray U in a DNA run, or a T in an RNA run, can no longer silently shorten your sequence.
Yes, now. Pick RNA as the nucleic acid type: base counts use U instead of T, pasted sequences must use A, U, G and C, and sequences of 14 bases or more use the published RNA equation from Sambrook and Russell, which is fitted separately from the DNA formula. Short RNA sequences use the Wallace rule with A plus U. The old behaviour, stripping every U out of a DNA run and returning a wrong, lower Tm, is gone: an RNA sequence pasted into a DNA run is now rejected with an error.
Start 3 to 5 degrees below the lower Tm of your primer pair, then adjust with a gradient run if the product is weak or non-specific. For a primer at 48.7 degrees, that is a first attempt near 44 to 46 degrees. Keep the two primers in a pair within about 5 degrees of each other.
Because the method changes at 14 bases. The Wallace rule and the salt-adjusted formulas were fitted on different sequence lengths and do not agree at the seam: an all-AT 14-mer scores 11.7 degrees C from the salt-adjusted DNA formula at 50 mM salt against 28.0 degrees C from Wallace arithmetic on the same bases.
Magnesium concentration, primer concentration, mismatches, secondary structure such as hairpins and primer-dimers, and the order of the bases beyond their counts. Salt is now accounted for in the long-sequence formulas, which is why that item no longer belongs on this list. All of these still move real Tm values, so confirm final primers with a nearest-neighbor tool set to your actual buffer.
Enter the monovalent salt concentration of your buffer in mM. The default 50 mM suits many standard buffers. The published RNA equation is valid from 10 to 400 mM (0.01 to 0.40 M); outside that range the tool still calculates but warns that the result is an extrapolation. Salt only affects sequences of 14 bases or more: the Wallace rule for short sequences has no salt term, so changing salt will not move a short-sequence result, and the badge says so.
Add This Calculator to Your Website
Embed this calculator on your own site with the code below. Pick a size to preview it live, then copy the code.
Powered by Calculator Zilo
References
- Wallace, R.B. et al. Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch, Nucleic Acids Research, 1979. Accessed October 22, 2026.
- SantaLucia, J. Jr. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, Proceedings of the National Academy of Sciences, 1998. Accessed October 22, 2026.
- Breslauer, K.J. et al. Predicting DNA duplex stability from the base sequence, Proceedings of the National Academy of Sciences, 1986. Accessed October 22, 2026.
- SantaLucia, J. Jr. and Hicks, D. The thermodynamics of DNA structural motifs, Annual Review of Biophysics and Biomolecular Structure, 2004. Accessed October 22, 2026.
- Rychlik, W., Spencer, W.J. and Rhoads, R.E. Optimization of the annealing temperature for DNA amplification in vitro, Nucleic Acids Research, 1990. Accessed October 22, 2026.
- National Center for Biotechnology Information (NCBI). Primer-BLAST: finding primers specific to your PCR template. Accessed October 22, 2026.
- Sambrook, J., and Russell, D. W. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2001. RNA melting temperature equation, Tm = 79.8 + 18.5 log10[Na+] + 58.4 (GC fraction) + 11.8 (GC fraction) squared minus 820 / length.
- Agilent Technologies. Equations for Calculating Tm: DNA-DNA, DNA-RNA and RNA-RNA equations with the 0.01 to 0.40 M salt and 30 to 75% GC validity ranges.